Read MR0000296091

Accession MR0000296091
Sequence 
ggccaaggaugagaacucuaaccugac
Organism Mus musculus
Stem-loop ID mmu-mir-3096a mmu-mir-3096b
Mature ID mmu-miR-3096a-5p mmu-miR-3096b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000218 7 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 27 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 15 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 17 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 27 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 12 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 11 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 3 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 17 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 20 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000236 14 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 1 thymus GEO : GSM539856
ER0000000238 8 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 11 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000241 18 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 11 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 9 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 5 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 4 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 1 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000254 1 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).