Read MR0000295035

Accession MR0000295035
Sequence 
uuguacaugguaggcuuucauuc
Organism Mus musculus
Stem-loop ID mmu-mir-493
Mature ID mmu-miR-493-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000236 4 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000248 3 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).