Read MR0000285765

Accession MR0000285765
Sequence 
aagcagcauuguacagggcua
Organism Mus musculus
Stem-loop ID mmu-mir-103-1 mmu-mir-103-2 mmu-mir-107
Mature ID mmu-miR-103-3p mmu-miR-103-3p mmu-miR-107-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000048 3 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000050 3 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 2 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 7 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000057 3 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 11 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 9 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 2 embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000216 2 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000222 2 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 3 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000228 2 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 1 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 6 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000233 1 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000236 2 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000239 2 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000241 4 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 7 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 4 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 4 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 3 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 2 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000260 3 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 4 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).