Read MR0000254926

Accession MR0000254926
Sequence 
guguucacagcggaccuuga
Organism Mus musculus
Stem-loop ID mmu-mir-124-3 mmu-mir-124-1 mmu-mir-124-2
Mature ID mmu-miR-124-5p mmu-miR-124-5p mmu-miR-124-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 2 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).