Read MR0000243943

Accession MR0000243943
Sequence 
cuccaguauugacugugcug
Organism Mus musculus
Stem-loop ID mmu-mir-16-1
Mature ID mmu-miR-16-1-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000222 1 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000242 1 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000260 1 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 2 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).