Read MR0000217674

Accession MR0000217674
Sequence 
cgcccuucccccccuucuuca
Organism Mus musculus
Stem-loop ID mmu-mir-1249
Mature ID mmu-miR-1249-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000050 1 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).