Read MR0000199694

Accession MR0000199694
Sequence 
ucccugagacccuaacuugugagg
Organism Mus musculus
Stem-loop ID mmu-mir-125b-2 mmu-mir-125b-1
Mature ID mmu-miR-125b-5p mmu-miR-125b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000038 2 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000039 1 brain GEO : GSM510443 [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000249 1 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).