Read MR0000198464

Accession MR0000198464
Sequence 
cuaccacaggguagaaccacgg
Organism Mus musculus
Stem-loop ID mmu-mir-140
Mature ID mmu-miR-140-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000216 3 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 6 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 11 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 16 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 50 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 1 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 6 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 6 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 15 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 4 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 1 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 2 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 28 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 55 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 9 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 2 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000236 3 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 14 thymus GEO : GSM539856
ER0000000238 11 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 24 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 2 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 12 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 7 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 12 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 51 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 31 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 12 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 7 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 7 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 5 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 2 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 1 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 3 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 5 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 9 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000260 7 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 30 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).