Read MR0000195978

Accession MR0000195978
Sequence
aauuaaggcacgcggugaaugccaa
Organism Mus musculus
Stem-loop ID mmu-mir-124-3 mmu-mir-124-1 mmu-mir-124-2
Mature ID mmu-miR-124-3p mmu-miR-124-3p mmu-miR-124-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 4 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 1 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000250 6 brain GEO : GSM539869 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
  • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).