Read MR0000192555

Accession MR0000192555
Sequence 
cgucaacacuugcugguuuucuc
Organism Mus musculus
Stem-loop ID mmu-mir-505
Mature ID mmu-miR-505-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000038 2 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 13 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 1 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 4 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 4 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000055 4 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000063 1 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000241 1 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000245 2 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).