Read MR0000187713

Accession MR0000187713
Sequence 
ugagguaguagguuguaugguuuag
Organism Mus musculus
Stem-loop ID mmu-let-7a-2 mmu-let-7c-1 mmu-let-7c-2
Mature ID mmu-let-7a-5p mmu-let-7c-5p mmu-let-7c-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000045 1 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 2 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000052 1 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000058 2 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 2 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 1 embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000216 710 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 175 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 429 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 725 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 107 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 94 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 27 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 9 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 135 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 603 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 460 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 78 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 13 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 1999 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 741 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 99 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 178 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 18 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 2127 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 2085 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 354 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 705 thymus GEO : GSM539856
ER0000000238 624 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 635 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 228 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 50 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 51 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 265 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 68 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 434 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 83 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 62 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 1495 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 350 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 1162 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 2709 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 286 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 2627 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 2758 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 2058 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 106 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 2911 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 169 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 12057 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 27 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 9 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).