Read MR0000181809

Accession MR0000181809
Sequence
aacaaacauggugcacuucu
Organism Mus musculus
Stem-loop ID mmu-mir-495
Mature ID mmu-miR-495-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 2 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 2 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 17 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 1 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 4 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 7 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 6 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 8 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 4 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 4 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 19 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000244 2 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 4 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 3 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 4 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000255 2 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
  • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).