Read MR0000175823

Accession MR0000175823
Sequence 
ggggugcuaucugugauugaggg
Organism Mus musculus
Stem-loop ID mmu-mir-342
Mature ID mmu-miR-342-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000043 2 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 1 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 3 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 3 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 3 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 19 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 6 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000058 3 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 4 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000062 1 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 7 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 4 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 10 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 6 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 18 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 5 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 11 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 14 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 3 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 5 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 4 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 7 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000234 3 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 2 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 5 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 2 thymus GEO : GSM539856
ER0000000238 4 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 8 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 2 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 11 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 5 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 16 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 48 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 5 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 5 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 2 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 2 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000261 5 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).