Read MR0000174028

Accession MR0000174028
Sequence 
gauaucagcucaguaggcaccg
Organism Mus musculus
Stem-loop ID mmu-mir-3074-1
Mature ID mmu-miR-3074-1-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000040 2 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000053 1 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000216 9 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 8 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 13 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 12 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 5 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 10 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 7 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 4 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 14 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 6 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 6 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 15 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 3 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 5 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 6 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 1 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 2 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000237 4 thymus GEO : GSM539856
ER0000000238 4 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 5 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 3 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 3 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 8 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 2 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 17 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000246 1 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000250 3 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 2 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 2 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000259 4 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 4 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 20 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).