Read MR0000171770

Accession MR0000171770
Sequence
agcuucuuuacagugcugccuugu
Organism Mus musculus
Stem-loop ID mmu-mir-103-1 mmu-mir-103-2 mmu-mir-107
Mature ID mmu-miR-103-1-5p mmu-miR-103-2-5p mmu-miR-107-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000040 6 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000041 1 whole body GEO : GSM510445 Newborn. [ Chiang HR et al.]
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 1 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 6 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 3 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 5 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 2 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 6 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 6 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 7 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 16 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000058 7 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 4 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 1 embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000216 2 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 2 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 1 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 7 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 1 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 4 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 4 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 1 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 5 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 7 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000239 2 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000241 7 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000243 8 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 7 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 4 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 3 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 2 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000260 4 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 4 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
  • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).