Read MR0000170076

Accession MR0000170076
Sequence 
gaugagguaguagauuguauaguu
Organism Mus musculus
Stem-loop ID mmu-let-7a-1 mmu-let-7f-2
Mature ID mmu-let-7a-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000040 3 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000059 1 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000229 1 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000239 1 spleen GEO : GSM539858 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).