Read MR0000167946

Accession MR0000167946
Sequence 
cucuacaaccuuaggacuugca
Organism Mus musculus
Stem-loop ID mmu-mir-676
Mature ID mmu-miR-676-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 13 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 1 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000045 2 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 4 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000048 1 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 2 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 3 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 10 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000062 1 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 2 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 1 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 2 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 1 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 1 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 2 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 1 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000235 2 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000240 1 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000247 25 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 12 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 2 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 36 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 6 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 3 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 8 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 58 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 21 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 2 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 13 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 4 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 15 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).