Read MR0000157330

Accession MR0000157330
Sequence 
uuaaaggauuuaccugaggccaau
Organism Mus musculus
Stem-loop ID mmu-mir-3096a mmu-mir-3096b
Mature ID mmu-miR-3096a-3p mmu-miR-3096b-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000036 1 brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000242 1 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).