Read MR0000156043

Accession MR0000156043
Sequence 
uuaaaggauuuaccugaggc
Organism Mus musculus
Stem-loop ID mmu-mir-3096a mmu-mir-3096b
Mature ID mmu-miR-3096a-3p mmu-miR-3096b-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000036 1 brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000040 2 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).