Read MR0000136476

Accession MR0000136476
Sequence 
cagugcaaugaugaaagggc
Organism Mus musculus
Stem-loop ID mmu-mir-130b
Mature ID mmu-miR-130b-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000033 1 testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000037 2 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000040 7 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 5 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 7 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000044 1 whole body GEO : GSM510448 Newborn. [ Chiang HR et al.]
ER0000000045 12 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 19 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 17 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 18 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 14 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 18 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 16 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 67 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 14 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 123 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 115 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 14 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000057 2 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 7 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 11 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 3 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 13 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 14 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 50 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 45 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 61 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 19 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 75 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 34 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 209 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 195 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 20 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 17 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 15 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 16 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 32 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 49 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 16 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 143 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 80 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 13 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 18 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 3 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 11 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 234 thymus GEO : GSM539856
ER0000000238 44 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 109 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 20 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 262 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 195 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 209 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 254 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 193 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 43 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 495 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 9 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 9 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 18 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 32 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 24 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 2 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 2 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 144 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 277 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).