Read MR0000130046

Accession MR0000130046
Sequence 
aaagcuggguugagagggcg
Organism Mus musculus
Stem-loop ID mmu-mir-320
Mature ID mmu-miR-320-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000032 1 testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000034 1 testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 5 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 18 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000046 1 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000048 1 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 1 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 1 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000052 2 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 1 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 1 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 3 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000058 1 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 2 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 4 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 10 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 181 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 118 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 136 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 77 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 170 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 125 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 120 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 191 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 149 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 118 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 32 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 160 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1184 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 68 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 54 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 424 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 69 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 13 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 63 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 21 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 119 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 144 thymus GEO : GSM539856
ER0000000238 78 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 147 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 60 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 129 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 449 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 171 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 377 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 131 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 247 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 70 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 104 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 21 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 105 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 83 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 26 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 181 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 29 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 172 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 34 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 207 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 3 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 152 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 112 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 355 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).