Read MR0000125468

Accession MR0000125468
Sequence 
ccuguucuugauuacuuguuu
Organism Mus musculus
Stem-loop ID mmu-mir-26a-2
Mature ID mmu-miR-26a-2-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000030 2 ovary GEO : GSM510434 [ Chiang HR et al.]
ER0000000037 1 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 1 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 2 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000055 1 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000058 2 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 1 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000231 2 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000238 1 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000240 1 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 3 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).