Read MR0000122161

Accession MR0000122161
Sequence 
ucuaauacugccggguaaugaug
Organism Mus musculus
Stem-loop ID mmu-mir-200b mmu-mir-200c
Mature ID mmu-miR-200b-3p mmu-miR-200c-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000029 1 ovary GEO : GSM510433 [ Chiang HR et al.]
ER0000000048 1 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000051 1 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 3 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).