Read MR0000120811

Accession MR0000120811
Sequence 
agcagcauuguacagggcuaugaag
Organism Mus musculus
Stem-loop ID mmu-mir-103-1 mmu-mir-103-2 mmu-mir-107
Mature ID mmu-miR-103-3p mmu-miR-103-3p mmu-miR-107-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000029 2 ovary GEO : GSM510433 [ Chiang HR et al.]
ER0000000036 2 brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000038 2 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 15 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000041 1 whole body GEO : GSM510445 Newborn. [ Chiang HR et al.]
ER0000000042 2 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000045 5 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 11 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 9 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 2 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 3 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 10 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 8 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 34 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 4 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 6 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 3 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 1 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000057 6 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 14 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 16 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 6 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 5 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 5 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 63 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 15 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 10 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 57 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 74 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 18 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 42 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 64 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 30 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 20 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 29 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 23 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 3 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 156 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 109 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 172 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 122 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 17 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 251 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 54 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 109 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 31 thymus GEO : GSM539856
ER0000000238 40 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 26 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 26 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 104 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 166 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 209 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 197 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 29 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 38 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 72 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 20 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 6 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 59 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 42 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 19 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 46 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 16 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 67 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 18 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 29 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 12 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 72 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 29 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 28 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).