Read MR0000116849

Accession MR0000116849
Sequence 
agcagcauuguacagggcuaucaa
Organism Mus musculus
Stem-loop ID mmu-mir-103-1 mmu-mir-103-2 mmu-mir-107
Mature ID mmu-miR-103-3p mmu-miR-103-3p mmu-miR-107-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000029 10 ovary GEO : GSM510433 [ Chiang HR et al.]
ER0000000030 8 ovary GEO : GSM510434 [ Chiang HR et al.]
ER0000000033 4 testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000034 1 testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000036 10 brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 35 brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 34 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000039 3 brain GEO : GSM510443 [ Chiang HR et al.]
ER0000000040 147 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 2 whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 1 whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 8 whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 6 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 11 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 9 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 12 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 8 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 7 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 42 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 5 embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 44 embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 66 embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 7 embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000057 1 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 3 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 2 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 8 embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 14 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 20 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 108 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 48 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 36 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 58 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 107 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 15 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 10 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 21 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 18 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 33 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 14 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 28 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 59 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 172 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 347 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 26 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 3 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 53 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 35 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 16 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 6 thymus GEO : GSM539856
ER0000000238 9 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 14 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 13 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 7 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 2 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 91 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 130 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 31 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 13 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 52 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 26 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 7 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 129 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 40 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 73 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 336 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 6 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 45 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 6 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 26 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 11 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 78 ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 9 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 41 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).