Read MR0000112839

Accession MR0000112839
Sequence 
acucuacaaccuuaggacuug
Organism Mus musculus
Stem-loop ID mmu-mir-676
Mature ID mmu-miR-676-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000029 1 ovary GEO : GSM510433 [ Chiang HR et al.]
ER0000000038 1 brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 3 brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000046 2 whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 1 whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 1 whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 2 whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 2 whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 7 whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 3 whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000057 1 embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 1 embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 2 embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000062 1 embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 1 embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 2 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 2 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 1 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 2 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000223 1 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 2 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 3 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 2 heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 7 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000253 2 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 25 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 11 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 9 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 6 testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 6 ovary GEO : GSM539878 strain: C57BL/6J, gender: female

References

1
PMID : 20413612
  • "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
    • Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).