Read MR0000109065

Accession MR0000109065
Sequence 
uuaguaggcguugugggaaggg
Organism Caenorhabditis elegans
Stem-loop ID cel-mir-253
Mature ID cel-miR-253-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000024 1 whole body GEO : GSM378784 [ de Wit E et al.]
ER0000000203 4 adult GEO : GSM604032 strain: N2 wild-type, age: Day 0 [ de Lencastre A et al.]
ER0000000204 18 adult GEO : GSM604033 strain: N2 wild-type, age: Day 10 [ de Lencastre A et al.]
ER0000000205 19 adult GEO : GSM604034 strain: daf-2(e1379) mutant, age: Day 0 [ de Lencastre A et al.]
ER0000000206 25 adult GEO : GSM604035 strain: daf-2(e1379) mutant, age: Day 10 [ de Lencastre A et al.]
ER0000000212 6 whole body GEO : GSM139137 mixed-stage [ Ruby JG et al.]

References

1
PMID : 19755563
  • "Repertoire and evolution of miRNA genes in four divergent nematode species"
    • de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).
    2
    PMID : 21129974
  • "MicroRNAs both promote and antagonize longevity in C. elegans"
    • de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).
    3
    PMID : 17174894
  • "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
    • Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).