Read MR0000098407

Accession MR0000098407
Sequence 
uaucacaguggcuguucuuuu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-6-1 dme-mir-6-2 dme-mir-6-3
Mature ID dme-miR-6-3p dme-miR-6-3p dme-miR-6-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000021 26 embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 2 embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 1 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000115 3 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000117 46 embryo GEO : GSM180330 very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 283 embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 290 embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 234 embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]
ER0000000121 3 whole body GEO : GSM180334 larvae: 1st instar and 3rd instars [ Ruby JG et al.]
ER0000000122 4 imaginal disc GEO : GSM180335 [ Ruby JG et al.]
ER0000000124 1 S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).