Read MR0000095584

Accession MR0000095584
Sequence 
uauccacuguaggccuauaug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-124
Mature ID dme-miR-124-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000021 8 embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 1 embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000083 1 head GEO : GSM322533 adult female head
ER0000000120 1 embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).