Read MR0000089835

Accession MR0000089835
Sequence 
agggaacgguugcugaugau
Organism Drosophila melanogaster
Stem-loop ID dme-mir-6-3
Mature ID dme-miR-6-3-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000019 32 embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000022 4 embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 15 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000118 2 embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).