Read MR0000084400

Accession MR0000084400
Sequence 
agggaauaguugcugugcug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-6-1
Mature ID dme-miR-6-1-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000018 14 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 81 embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000020 10 embryo GEO : GSM286606 [ Chung WJ et al.]
ER0000000022 5 embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 28 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000087 1 whole body GEO : GSM360260 0-1 day old pupae
ER0000000117 1 embryo GEO : GSM180330 very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 7 embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 1 embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).