Read MR0000068277

Accession MR0000068277
Sequence 
ucccuaacggagucagauug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-929
Mature ID dme-miR-929-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000014 1 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000083 4 head GEO : GSM322533 adult female head
ER0000000084 2 head GEO : GSM322543 adult male head
ER0000000101 2 whole body GEO : GSM399107 male body

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).