Read MR0000066871

Accession MR0000066871
Sequence
uuaaacacuuccuacauccug
Organism Drosophila melanogaster
Stem-loop ID dme-mir-975
Mature ID dme-miR-975-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000014 1 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000018 3 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000089 1 embryo GEO : GSM364902 12-24hr embryo
ER0000000093 127 whole body GEO : GSM280085 from 2-4 day old flies
ER0000000101 3 whole body GEO : GSM399107 male body
ER0000000122 1 imaginal disc GEO : GSM180335 [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).