Read MR0000062653

Accession MR0000062653
Sequence 
cuuaucauucucucgccccg
Organism Drosophila melanogaster
Stem-loop ID dme-mir-184
Mature ID dme-miR-184-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000012 2 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 1 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000023 1 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000095 5 S2 cell GEO : GSM280087
ER0000000096 2 S2 cell GEO : GSM280088
ER0000000102 1 S2 cell GEO : GSM371638
ER0000000127 1 ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 1 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 2 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).