Read MR0000061299

Accession MR0000061299
Sequence
uagguuucacaggaaacugguuu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-303
Mature ID dme-miR-303-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000012 1 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 1 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 6 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000016 3 whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000018 5 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000081 1 whole body GEO : GSM322245 3rd instar larvae
ER0000000093 5 whole body GEO : GSM280085 from 2-4 day old flies
ER0000000099 3 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000101 5 whole body GEO : GSM399107 male body
ER0000000121 1 whole body GEO : GSM180334 larvae: 1st instar and 3rd instars [ Ruby JG et al.]
ER0000000127 2 ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 2 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 2 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).