Read MR0000057578

Accession MR0000057578
Sequence 
uggacggagaacugauaagggcuc
Organism Drosophila melanogaster
Stem-loop ID dme-mir-184
Mature ID dme-miR-184-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000011 1 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 2 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 3 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000092 2 whole body GEO : GSM280084 from 2-4 day old flies
ER0000000096 4 S2 cell GEO : GSM280088
ER0000000102 32 S2 cell GEO : GSM371638
ER0000000124 1 S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000128 1 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 1 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).