Read MR0000057060

Accession MR0000057060
Sequence 
agagagcuauccgucgacaguc
Organism Drosophila melanogaster
Stem-loop ID dme-mir-281-1 dme-mir-281-2
Mature ID dme-miR-281-1-5p dme-miR-281-2-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000011 1 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 3 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000016 1 whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000017 1 whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 3 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000021 2 embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000023 1 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000080 1 whole body GEO : GSM322219 2-4 day old pupae
ER0000000082 1 whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 2 head GEO : GSM322533 adult female head
ER0000000087 5 whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 6 whole body GEO : GSM360262 0-2 day old pupae
ER0000000091 2 whole body GEO : GSM280083 from 2-4 day old flies
ER0000000096 1 S2 cell GEO : GSM280088
ER0000000099 1 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000100 3 whole body GEO : GSM399106 female body
ER0000000101 13 whole body GEO : GSM399107 male body
ER0000000124 1 S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000128 1 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 2 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).