Read MR0000052265

AccessionMR0000052265
Sequence
ucacucaaggagguugugaugg
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER00000000101HeadGEO : GSM240749 [ Chung WJ et al.]
ER00000000791Whole bodyGEO : GSM3222083rd instar larvae
ER00000000803Whole bodyGEO : GSM3222192-4 day old pupae
ER00000000831HeadGEO : GSM322533Age: Adult; Gender: Female
ER00000000846HeadGEO : GSM322543Age: Adult; Gender: Male
ER00000001012Whole bodyGEO : GSM399107Gender: Male

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).