Read MR0000047658

Accession MR0000047658
Sequence 
uaaguacuagugccgcaggaguu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-252
Mature ID dme-miR-252-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 1 head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 4 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 18 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 1 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000015 4 head GEO : GSM286601 [ Chung WJ et al.]
ER0000000016 1 whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000018 1 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000021 3 embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000080 3 whole body GEO : GSM322219 2-4 day old pupae
ER0000000083 11 head GEO : GSM322533 adult female head
ER0000000084 35 head GEO : GSM322543 adult male head
ER0000000085 1 whole body GEO : GSM360256 1st instar larvae
ER0000000086 1 whole body GEO : GSM360257 1st instar larvae
ER0000000087 4 whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 5 whole body GEO : GSM360262 0-2 day old pupae
ER0000000096 1 S2 cell GEO : GSM280088
ER0000000100 4 whole body GEO : GSM399106 female body
ER0000000101 4 whole body GEO : GSM399107 male body
ER0000000102 7 S2 cell GEO : GSM371638
ER0000000115 5 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000124 4 S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).