Read MR0000046882

AccessionMR0000046882
Sequence
cccaggaaucgaacauauuauu
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-190

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueSRA accessionCommentReference
ER00000001021S2 cellSRR015372