Read MR0000032539

Accession MR0000032539
Sequence
ucacacccagguugagugagu
Organism Drosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 1 head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 3 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 1 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 2 Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 9 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 107 head GEO : GSM286601 [ Chung WJ et al.]
ER0000000016 4 whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000017 1 whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 2 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 2 embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000080 2 whole body GEO : GSM322219 2-4 day old pupae
ER0000000081 2 whole body GEO : GSM322245 3rd instar larvae
ER0000000082 9 whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 2 head GEO : GSM322533 adult female head
ER0000000084 1419 head GEO : GSM322543 adult male head
ER0000000085 1 whole body GEO : GSM360256 1st instar larvae
ER0000000087 22 whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 54 whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 1 embryo GEO : GSM364902 12-24hr embryo
ER0000000092 5 whole body GEO : GSM280084 from 2-4 day old flies
ER0000000093 1 whole body GEO : GSM280085 from 2-4 day old flies
ER0000000095 1 S2 cell GEO : GSM280087
ER0000000096 1 S2 cell GEO : GSM280088
ER0000000099 19 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000100 1 whole body GEO : GSM399106 female body
ER0000000101 1 whole body GEO : GSM399107 male body
ER0000000102 4 S2 cell GEO : GSM371638
ER0000000115 30 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000122 2 imaginal disc GEO : GSM180335 [ Ruby JG et al.]
ER0000000123 1 whole body GEO : GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day [ Ruby JG et al.]
ER0000000124 2 S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000127 180 ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 383 ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 531 ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 155 ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).