Read MR0000032539

AccessionMR0000032539
Sequence
uggcaguaugguuagcugguugug
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-34

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueSRA accessionCommentReference
ER00000000103headSRR068998 1946
ER00000000123S2 cellSRR069830 1946
ER00000000152headSRR069835 1946
ER00000000161whole bodySRR069836 1946
ER00000000221embryoSRR069839 1946
ER00000000837headSRR013604adult female head
ER00000001002whole bodySRR018039female body
ER00000001013whole bodySRR016854male body
ER00000001024S2 cellSRR015372