Read MR0000032539

AccessionMR0000032539
Sequence
ucacacccagguugagugagu
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-307b

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER00000000101HeadGEO : GSM240749 [ Chung WJ et al.]
ER00000000113S2 cellGEO : GSM272651 [ Chung WJ et al.]
ER00000000121S2 cellGEO : GSM272652 [ Chung WJ et al.]
ER00000000132Kc cellGEO : GSM272653 [ Chung WJ et al.]
ER00000000149Imaginal discGEO : GSM275691 [ Chung WJ et al.]
ER0000000015107HeadGEO : GSM286601 [ Chung WJ et al.]
ER00000000164Whole bodyGEO : GSM286602 [ Chung WJ et al.]
ER00000000171Whole bodyGEO : GSM286603 [ Chung WJ et al.]
ER00000000182EmbryoGEO : GSM286604 [ Chung WJ et al.]
ER00000000192EmbryoGEO : GSM286605 [ Chung WJ et al.]
ER00000000791Whole bodyGEO : GSM3222083rd instar larvae
ER00000000802Whole bodyGEO : GSM3222192-4 day old pupae
ER00000000812Whole bodyGEO : GSM3222453rd instar larvae
ER00000000829Whole bodyGEO : GSM3223382-4 day old pupae
ER00000000832HeadGEO : GSM322533Age: Adult; Gender: Female
ER00000000841419HeadGEO : GSM322543Age: Adult; Gender: Male
ER00000000851Whole bodyGEO : GSM3602561st instar larvae
ER000000008722Whole bodyGEO : GSM3602600-1 day old pupae
ER000000008854Whole bodyGEO : GSM3602620-2 day old pupae
ER00000000891EmbryoGEO : GSM364902Age: 12-24 hours
ER00000000925Whole bodyGEO : GSM280084Age: 2-4 days
ER00000000931Whole bodyGEO : GSM280085Age: 2-4 days
ER00000000951S2 cellGEO : GSM280087
ER00000000961S2 cellGEO : GSM280088
ER000000009919Imaginal discGEO : GSM399105Imaginal disc/brain
ER00000001001Whole bodyGEO : GSM399106Gender: Female
ER00000001011Whole bodyGEO : GSM399107Gender: Male
ER00000001024S2 cellGEO : GSM371638
ER000000011530HeadGEO : GSM180328Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER00000001222Imaginal discGEO : GSM180335 [ Ruby JG et al.]
ER00000001231Whole bodyGEO : GSM180336Pupae: 0-1 day, 0-2 day, 2-4 day[ Ruby JG et al.]
ER00000001242S2 cellGEO : GSM180337Tissue culture cells (S2 only)[ Ruby JG et al.]
ER0000000127180OvaryGEO : GSM385744Ovary Somatic Sheet (OSS) cells
ER0000000128383OvaryGEO : GSM385748Ovary Somatic Sheet (OSS) cells
ER0000000129531OvaryGEO : GSM385821Ovary Somatic Sheet (OSS) cells
ER0000000130155OvaryGEO : GSM385822Ovary Somatic Sheet (OSS) cells

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).