Read MR0000028715

Accession MR0000028715
Sequence
aaaguaaauagucuggauugau
Organism Drosophila melanogaster
Stem-loop ID dme-mir-987
Mature ID dme-miR-987-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 23 head GEO : GSM240749 [ Chung WJ et al.]
ER0000000014 2 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 5 head GEO : GSM286601 [ Chung WJ et al.]
ER0000000018 1 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000080 2 whole body GEO : GSM322219 2-4 day old pupae
ER0000000083 31 head GEO : GSM322533 adult female head
ER0000000084 209 head GEO : GSM322543 adult male head
ER0000000092 1 whole body GEO : GSM280084 from 2-4 day old flies
ER0000000095 3 S2 cell GEO : GSM280087
ER0000000096 132 S2 cell GEO : GSM280088
ER0000000099 1 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000101 8 whole body GEO : GSM399107 male body
ER0000000102 228 S2 cell GEO : GSM371638
ER0000000115 3 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
  • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).