Read MR0000025837

Accession MR0000025837
Sequence 
ccugcugcccaagugcuuauuaa
Organism Drosophila melanogaster
Stem-loop ID dme-mir-252
Mature ID dme-miR-252-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000010 3 head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 3 S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 7 S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000014 1 imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000018 9 embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000023 2 embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000079 1 whole body GEO : GSM322208 3rd instar larvae
ER0000000082 1 whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 3 head GEO : GSM322533 adult female head
ER0000000084 1 head GEO : GSM322543 adult male head
ER0000000087 2 whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 2 whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 2 embryo GEO : GSM364902 12-24hr embryo
ER0000000099 1 imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000101 1 whole body GEO : GSM399107 male body
ER0000000115 1 head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000119 2 embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]

References

1
PMID : 18501606
  • "Endogenous RNA interference provides a somatic defense against Drosophila transposons"
    • Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).
    2
    PMID : 17989254
  • "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
    • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).