Read MR0000024057

Accession MR0000024057
Sequence 
uuuccugaugccucccauucc
Organism Oryza sativa
Stem-loop ID osa-MIR2118b osa-MIR2118d osa-MIR2118f osa-MIR2118g osa-MIR2118h osa-MIR2118j osa-MIR2118k osa-MIR2118m osa-MIR2118n osa-MIR2118p
Mature ID osa-miR2118b osa-miR2118d osa-miR2118f osa-miR2118g osa-miR2118h osa-miR2118j osa-miR2118k osa-miR2118m osa-miR2118n osa-miR2118p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000009 1 whole body GEO : GSM407072 [ Johnson C et al.]

References

1
PMID : 19584097
  • "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
    • Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).