Read MR0000023226

Accession MR0000023226
Sequence 
ugccaaaggagaauugcccug
Organism Oryza sativa
Stem-loop ID osa-MIR399a osa-MIR399b osa-MIR399c osa-MIR399d osa-MIR399e osa-MIR399f osa-MIR399g osa-MIR399h osa-MIR399j
Mature ID osa-miR399a osa-miR399b osa-miR399c osa-miR399d osa-miR399e osa-miR399f osa-miR399g osa-miR399h osa-miR399j

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000009 1 whole body GEO : GSM407072 [ Johnson C et al.]

References

1
PMID : 19584097
  • "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
    • Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).