Read MR0000019073

Accession MR0000019073
Sequence
agauugcuuucaaggucauuucuu
Organism Oryza sativa
Stem-loop ID osa-MIR1882a osa-MIR1882b osa-MIR1882c osa-MIR1882d osa-MIR1882e osa-MIR1882f osa-MIR1882g osa-MIR1882h osa-MIR1317
Mature ID osa-miR1882a osa-miR1882b osa-miR1882c osa-miR1882d osa-miR1882e osa-miR1882f osa-miR1882g osa-miR1882h osa-miR1317-5p.2-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000009 4 whole body GEO : GSM407072 [ Johnson C et al.]

References

1
PMID : 19584097
  • "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
  • Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).