Read MR0000017233

Accession MR0000017233
Sequence 
ugaagcugccagcaugaucugg
Organism Oryza sativa
Stem-loop ID osa-MIR167a osa-MIR167b osa-MIR167c osa-MIR167d osa-MIR167e osa-MIR167f osa-MIR167g osa-MIR167h osa-MIR167i osa-MIR167j
Mature ID osa-miR167a-5p osa-miR167b osa-miR167c-5p osa-miR167d-5p osa-miR167e-5p osa-miR167f osa-miR167g osa-miR167h-5p osa-miR167i-5p osa-miR167j

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000008 34 whole body GEO : GSM407071 [ Johnson C et al.]
ER0000000009 15 whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000201 22 whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 22 whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]

References

1
PMID : 19584097
  • "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
    • Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
    2
    PMID : 21113019
  • "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)"
    • Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).