Read MR0000016190

Accession MR0000016190
Sequence
gaacugccuuaaggaagucgaug
Organism Oryza sativa
Stem-loop ID osa-MIR820a osa-MIR820b osa-MIR820c

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000008 3 whole body GEO : GSM407071 [ Johnson C et al.]
ER0000000009 8 whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000201 23 whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 23 whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]

References

1
PMID : 19584097
  • "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
  • Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
    2