Read MR0000016089

Accession MR0000016089
Sequence
cggucuugaggcaggaacuga
Organism Oryza sativa
Stem-loop ID osa-MIR1861b osa-MIR1861d osa-MIR1861f osa-MIR1861h osa-MIR1861i osa-MIR1861j osa-MIR1861l
Mature ID osa-miR1861b osa-miR1861d osa-miR1861f osa-miR1861h osa-miR1861i osa-miR1861j osa-miR1861l

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000008 2 whole body GEO : GSM407071 [ Johnson C et al.]
ER0000000009 1 whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000201 21 whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 21 whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]

References

1
PMID : 19584097
  • "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
  • Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
    2