Read MR0000011685

Accession MR0000011685
Sequence 
aaggaguggcaugugaacac
Organism Arabidopsis thaliana
Stem-loop ID ath-MIR398a

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000004 4 whole body GEO : GSM253623 [ Mi S et al.]
ER0000000005 3 whole body GEO : GSM253624 [ Mi S et al.]

References

1
PMID : 18342361
  • "Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide"
    • Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y. Cell. 133:116-127(2008).